Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4387462
End position: 4387485
Length: 24

DNA sequence
>NC_012669, from 4387462 to 4387485 (24 bp); Beutenbergia cavernae DSM 12333 GCCTCGGCCTCGGCGTCGACCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4387294-4388529	Sequence	Bcav_3967 - pyruvate dehydrogenase E1 component subunit alpha (Protein is coded in complementary strand; from 4388529 to 4387294)