Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4351460
End position: 4351483
Length: 24

DNA sequence
>NC_012669, from 4351460 to 4351483 (24 bp); Beutenbergia cavernae DSM 12333 TCCTCGCCCTCGCCCTCGACCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4351271-4352323	Sequence	Bcav_3934 - hypothetical protein (Protein is coded in complementary strand; from 4352323 to 4351271)