Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 431220
End position: 431249
Length: 30

DNA sequence
>NC_012669, from 431220 to 431249 (30 bp); Beutenbergia cavernae DSM 12333 CACTCCCGCGCACTCTCGGGCACGCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 430737-434333	Sequence	Bcav_0385 - adenylate/guanylate cyclase (Protein is coded in complementary strand; from 434333 to 430737)