Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 429468
End position: 429503
Length: 36

DNA sequence
>NC_012669, from 429468 to 429503 (36 bp); Beutenbergia cavernae DSM 12333 CGAGGGCGTCCTCGGCGGCGTCCTGGAGCGCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 428369-429631	Sequence	Bcav_0382 - ECF subfamily RNA polymerase sigma-24 subunit (Protein is coded in complementary strand; from 429631 to 428369)