Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4217118
End position: 4217171
Length: 54

DNA sequence
>NC_012669, from 4217118 to 4217171 (54 bp); Beutenbergia cavernae DSM 12333 CCGGACGATCCGACCGACCCGGTGGACCCGACCGACCCCGTCGACCCGACCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4215652-4217358	Sequence	Bcav_3799 - LPXTG-motif cell wall anchor domain-containing protein