Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4198827
End position: 4198850
Length: 24

DNA sequence
>NC_012669, from 4198827 to 4198850 (24 bp); Beutenbergia cavernae DSM 12333 GGCGAGAGCGAGGACGAGGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4198666-4200342	Sequence	Bcav_3782 - potassium-transporting ATPase subunit A (Protein is coded in complementary strand; from 4200342 to 4198666)