Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4159640
End position: 4159684
Length: 45

DNA sequence
>NC_012669, from 4159640 to 4159684 (45 bp); Beutenbergia cavernae DSM 12333 CCGCTCAGGTCGGCGCCGCGCAGGTCGGTGTCCCGCAGGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4159544-4160386	Sequence	Bcav_3741 - pentapeptide repeat-containing protein (Protein is coded in complementary strand; from 4160386 to 4159544)