Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4101158
End position: 4101202
Length: 45

DNA sequence
>NC_012669, from 4101158 to 4101202 (45 bp); Beutenbergia cavernae DSM 12333 GCGGCGAGAGCGGCGAGAGCGGCGAGAGCGGCGAGAGCGGCGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4098986-4101310	Sequence	Bcav_3684 - LPXTG-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 4101310 to 4098986)