Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4057177
End position: 4057233
Length: 57

DNA sequence
>NC_012669, from 4057177 to 4057233 (57 bp); Beutenbergia cavernae DSM 12333 CCGCTCACCCCTGGGGCGGCCGCTCACCCCTGGGGCGGCCGCTCACCCCTGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4057220-4057969	Sequence	Bcav_3645 - LemA family protein (Protein is coded in complementary strand; from 4057969 to 4057220)