Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4040249
End position: 4040278
Length: 30

DNA sequence
>NC_012669, from 4040249 to 4040278 (30 bp); Beutenbergia cavernae DSM 12333 AGGCGCAGGCACAGGCGACGGCGCTGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4039422-4041653	Sequence	Bcav_3627 - HNH endonuclease (Protein is coded in complementary strand; from 4041653 to 4039422)