Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 4033598
End position: 4033624
Length: 27

DNA sequence
>NC_012669, from 4033598 to 4033624 (27 bp); Beutenbergia cavernae DSM 12333 CGCCACCGCCGCCCCCGCCGCCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4032376-4033704	Sequence	Bcav_3623 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 4033704 to 4032376)