Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3966373
End position: 3966396
Length: 24

DNA sequence
>NC_012669, from 3966373 to 3966396 (24 bp); Beutenbergia cavernae DSM 12333 CGACGGCGAAGGCGACGGCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3965736-3967313	Sequence	Bcav_3570 - hypothetical protein (Protein is coded in complementary strand; from 3967313 to 3965736)