Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3945394
End position: 3945447
Length: 54

DNA sequence
>NC_012669, from 3945394 to 3945447 (54 bp); Beutenbergia cavernae DSM 12333 CCGAGCGGCCGGGCCTGACCGGGCGGCCGGGCCCGAGCGGGCGGCCGGGCCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3945446-3946039	Sequence	Bcav_3551 - NADPH-dependent FMN reductase (Protein is coded in complementary strand; from 3946039 to 3945446)