Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3935814
End position: 3935840
Length: 27

DNA sequence
>NC_012669, from 3935814 to 3935840 (27 bp); Beutenbergia cavernae DSM 12333 CCCGCCGGGCCCGCGGGGACCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3935802-3937097	Sequence	Bcav_3542 - histidine kinase (Protein is coded in complementary strand; from 3937097 to 3935802)