Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3932943
End position: 3932966
Length: 24

DNA sequence
>NC_012669, from 3932943 to 3932966 (24 bp); Beutenbergia cavernae DSM 12333 CGCCGACGTCGATGCCGACGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3932054-3933007	Sequence	Bcav_3538 - ROK family protein (Protein is coded in complementary strand; from 3933007 to 3932054)