Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3773930
End position: 3773956
Length: 27

DNA sequence
>NC_012669, from 3773930 to 3773956 (27 bp); Beutenbergia cavernae DSM 12333 CTCCGGCGGCTCCGGCGACTCCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3773851-3775494	Sequence	Bcav_3388 - family 1 extracellular solute-binding protein