Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 375617
End position: 375670
Length: 54

DNA sequence
>NC_012669, from 375617 to 375670 (54 bp); Beutenbergia cavernae DSM 12333 CGCCCGCCGGGGCTCGGGCTCTCGCCGGGGCTGGGGCTCTCGCCGGGGCTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 375371-376417	Sequence	Bcav_0349 - AfsR-like transcriptional regulator (Protein is coded in complementary strand; from 376417 to 375371)