Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3577037
End position: 3577060
Length: 24

DNA sequence
>NC_012669, from 3577037 to 3577060 (24 bp); Beutenbergia cavernae DSM 12333 ACGAGCATGAGCACGAACACGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3576428-3577288	Sequence	Bcav_3220 - NADH dehydrogenase subunit J (Protein is coded in complementary strand; from 3577288 to 3576428)