Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 353131
End position: 353175
Length: 45

DNA sequence
>NC_012669, from 353131 to 353175 (45 bp); Beutenbergia cavernae DSM 12333 CCGACGTCGAGCGGGCCGCCGTCGACCTGGCGGACGTCCACCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 352726-353853	Sequence	Bcav_0329 - aromatic amino acid beta-eliminating lyase/threonine aldolase