Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3518038
End position: 3518082
Length: 45

DNA sequence
>NC_012669, from 3518038 to 3518082 (45 bp); Beutenbergia cavernae DSM 12333 GGGCTCGTCGGAGGTGGGCTCGTCGGAGGTGGGCTCGGCCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3517400-3518179	Sequence	Bcav_3162 - NusG antitermination factor (Protein is coded in complementary strand; from 3518179 to 3517400)