Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 350995
End position: 351018
Length: 24

DNA sequence
>NC_012669, from 350995 to 351018 (24 bp); Beutenbergia cavernae DSM 12333 TCGACGTCCACGTCGACGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 350404-351117	Sequence	Bcav_0326 - DSBA oxidoreductase (Protein is coded in complementary strand; from 351117 to 350404)