Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3487005
End position: 3487049
Length: 45

DNA sequence
>NC_012669, from 3487005 to 3487049 (45 bp); Beutenbergia cavernae DSM 12333 GTCACCGCCCCGGCGGTCGCCGCCGCGGCGGTCCCCACCCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3486454-3487134	Sequence	Bcav_3126 - 30S ribosomal protein S5 (Protein is coded in complementary strand; from 3487134 to 3486454)