Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3408452
End position: 3408487
Length: 36

DNA sequence
>NC_012669, from 3408452 to 3408487 (36 bp); Beutenbergia cavernae DSM 12333 GATCGCCGCCGCGCTGGCCGCCGCGATCGCCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3408199-3409050	Sequence	Bcav_3054 - Exonuclease RNase T and DNA polymerase III