Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3386945
End position: 3386968
Length: 24

DNA sequence
>NC_012669, from 3386945 to 3386968 (24 bp); Beutenbergia cavernae DSM 12333 CGGCGCCGGCGTCGGGGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3386539-3387699	Sequence	Bcav_3037 - group 1 glycosyl transferase (Protein is coded in complementary strand; from 3387699 to 3386539)