Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3369800
End position: 3369824
Length: 25

DNA sequence
>NC_012669, from 3369800 to 3369824 (25 bp); Beutenbergia cavernae DSM 12333 CGCGGGGCGGGGCGGCGCGAGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3369062-3371002	Sequence	Bcav_3022 - acyltransferase 3 (Protein is coded in complementary strand; from 3371002 to 3369062)