Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3363867
End position: 3363890
Length: 24

DNA sequence
>NC_012669, from 3363867 to 3363890 (24 bp); Beutenbergia cavernae DSM 12333 CGGCGACGACGACGCCGAGGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3363671-3364924	Sequence	Bcav_3015 - hypothetical protein (Protein is coded in complementary strand; from 3364924 to 3363671)