Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3310766
End position: 3310789
Length: 24

DNA sequence
>NC_012669, from 3310766 to 3310789 (24 bp); Beutenbergia cavernae DSM 12333 TCGCCGTCGACGTCGTCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3310673-3311224	Sequence	Bcav_2967 - ArsR family transcriptional regulator (Protein is coded in complementary strand; from 3311224 to 3310673)