Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3259517
End position: 3259540
Length: 24

DNA sequence
>NC_012669, from 3259517 to 3259540 (24 bp); Beutenbergia cavernae DSM 12333 CTTCGGCTTGGGTTTCGGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3259434-3259817	Sequence	Bcav_2918 - twin-arginine translocation protein subunit TatB (Protein is coded in complementary strand; from 3259817 to 3259434)