Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3219247
End position: 3219306
Length: 60

DNA sequence
>NC_012669, from 3219247 to 3219306 (60 bp); Beutenbergia cavernae DSM 12333 GTCGGTCGGTTCCTCGGTCGGCTCGTCCGTCGGCTCCTCGGTCGGCTCCTCCGTCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3219056-3221998	Sequence	Bcav_2885 - hypothetical protein (Protein is coded in complementary strand; from 3221998 to 3219056)