Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3165177
End position: 3165200
Length: 24

DNA sequence
>NC_012669, from 3165177 to 3165200 (24 bp); Beutenbergia cavernae DSM 12333 CCTCCGCCTCCGCCCCCGCCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3163968-3165326	Sequence	Bcav_2834 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 3165326 to 3163968)