Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 316363
End position: 316392
Length: 30

DNA sequence
>NC_012669, from 316363 to 316392 (30 bp); Beutenbergia cavernae DSM 12333 GAGGGCGCGGGCGAGGACGACGGCGAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 315500-316645	Sequence	Bcav_0293 - esterase/lipase (Protein is coded in complementary strand; from 316645 to 315500)