Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 3110959
End position: 3110982
Length: 24

DNA sequence
>NC_012669, from 3110959 to 3110982 (24 bp); Beutenbergia cavernae DSM 12333 CGAGCCCGATCCCGAGGCCGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3110088-3111035	Sequence	Bcav_2789 - type II secretion system protein (Protein is coded in complementary strand; from 3111035 to 3110088)