Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 308828
End position: 308851
Length: 24

DNA sequence
>NC_012669, from 308828 to 308851 (24 bp); Beutenbergia cavernae DSM 12333 GTCCAGGTCCGGCTCCAGGTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 308307-308918	Sequence	Bcav_0286 - two component LuxR family transcriptional regulator (Protein is coded in complementary strand; from 308918 to 308307)