Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2985146
End position: 2985175
Length: 30

DNA sequence
>NC_012669, from 2985146 to 2985175 (30 bp); Beutenbergia cavernae DSM 12333 CGTCGGGTCGGGTCGGGTCGGGTCGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2985174-2985845	Sequence	Bcav_2689 - two component LuxR family transcriptional regulator (Protein is coded in complementary strand; from 2985845 to 2985174)