Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2972779
End position: 2972814
Length: 36

DNA sequence
>NC_012669, from 2972779 to 2972814 (36 bp); Beutenbergia cavernae DSM 12333 CACGAGGATCGTCACGAGGATGATCACGACGAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2972690-2973583	Sequence	Bcav_2675 - phosphonate ABC transporter permease (Protein is coded in complementary strand; from 2973583 to 2972690)