Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2942231
End position: 2942254
Length: 24

DNA sequence
>NC_012669, from 2942231 to 2942254 (24 bp); Beutenbergia cavernae DSM 12333 CCTCCGCGTCCGCCGCCGGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2942188-2942709	Sequence	Bcav_2643 - single-strand binding protein (Protein is coded in complementary strand; from 2942709 to 2942188)