Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2857039
End position: 2857065
Length: 27

DNA sequence
>NC_012669, from 2857039 to 2857065 (27 bp); Beutenbergia cavernae DSM 12333 TCGGTGGTGCCGGTGGTGTCGGAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2854576-2857872	Sequence	Bcav_2568 ileS isoleucyl-tRNA synthetase (Protein is coded in complementary strand; from 2857872 to 2854576)