Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2800931
End position: 2800960
Length: 30

DNA sequence
>NC_012669, from 2800931 to 2800960 (30 bp); Beutenbergia cavernae DSM 12333 CTCAGCCTCAACCTCCGCCTCGGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2800833-2801894	Sequence	Bcav_2507 - 30S ribosomal protein S2 (Protein is coded in complementary strand; from 2801894 to 2800833)