Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2798229
End position: 2798255
Length: 27

DNA sequence
>NC_012669, from 2798229 to 2798255 (27 bp); Beutenbergia cavernae DSM 12333 GATCCTCGCGATCCTCGCGCTCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2797298-2798509	Sequence	Bcav_2503 - phosphatidate cytidylyltransferase (Protein is coded in complementary strand; from 2798509 to 2797298)