Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2794396
End position: 2794419
Length: 24

DNA sequence
>NC_012669, from 2794396 to 2794419 (24 bp); Beutenbergia cavernae DSM 12333 GCGCCCGCGACCGCGCTCGTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2794365-2795549	Sequence	Bcav_2500 - 1-deoxy-D-xylulose 5-phosphate reductoisomerase (Protein is coded in complementary strand; from 2795549 to 2794365)