Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2734489
End position: 2734533
Length: 45

DNA sequence
>NC_012669, from 2734489 to 2734533 (45 bp); Beutenbergia cavernae DSM 12333 CCGGCGACGAGGAGACGGGCGGGGAGGAGACCGGCGGCGAGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2734411-2735295	Sequence	Bcav_2444 - family 3 extracellular solute-binding protein