Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2699691
End position: 2699714
Length: 24

DNA sequence
>NC_012669, from 2699691 to 2699714 (24 bp); Beutenbergia cavernae DSM 12333 CGGGCGAGGGCGCGGGCGCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2699556-2701073	Sequence	Bcav_2412 - UDP-N-acetylmuramoylalanine--D-glutamate ligase (Protein is coded in complementary strand; from 2701073 to 2699556)