Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2687728
End position: 2687751
Length: 24

DNA sequence
>NC_012669, from 2687728 to 2687751 (24 bp); Beutenbergia cavernae DSM 12333 GCTCGTGCGCGTGCTCGTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2684874-2688446	Sequence	Bcav_2399 dnaE DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 2688446 to 2684874)