Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2658573
End position: 2658596
Length: 24

DNA sequence
>NC_012669, from 2658573 to 2658596 (24 bp); Beutenbergia cavernae DSM 12333 GAGCGCCAGCGCGAGCTCGAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2657695-2658687	Sequence	Bcav_2369 - ornithine carbamoyltransferase (Protein is coded in complementary strand; from 2658687 to 2657695)