Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2597773
End position: 2597796
Length: 24

DNA sequence
>NC_012669, from 2597773 to 2597796 (24 bp); Beutenbergia cavernae DSM 12333 AGGACGGGGACGACGACGAGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2596543-2598276	Sequence	Bcav_2312 - ABC transporter permease (Protein is coded in complementary strand; from 2598276 to 2596543)