Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2584553
End position: 2584576
Length: 24

DNA sequence
>NC_012669, from 2584553 to 2584576 (24 bp); Beutenbergia cavernae DSM 12333 CACGACGACGACCATGACGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2584500-2585156	Sequence	Bcav_2300 - binding-protein-dependent transport system inner membrane protein (Protein is coded in complementary strand; from 2585156 to 2584500)