Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 25839
End position: 25862
Length: 24

DNA sequence
>NC_012669, from 25839 to 25862 (24 bp); Beutenbergia cavernae DSM 12333 GCCGCCGTCGCCGCCGCGGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 24999-26804	Sequence	Bcav_0026 - serine/threonine protein kinase with PASTA sensor(s) (Protein is coded in complementary strand; from 26804 to 24999)