Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2577629
End position: 2577652
Length: 24

DNA sequence
>NC_012669, from 2577629 to 2577652 (24 bp); Beutenbergia cavernae DSM 12333 TCGGCGTCGACGTCGACGTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2577449-2578381	Sequence	Bcav_2292 - FAD-binding 9 siderophore-interacting domain-containing protein (Protein is coded in complementary strand; from 2578381 to 2577449)