Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2528676
End position: 2528702
Length: 27

DNA sequence
>NC_012669, from 2528676 to 2528702 (27 bp); Beutenbergia cavernae DSM 12333 GGCGTCGACGCCGTCGACGGCGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2528647-2529627	Sequence	Bcav_2248 - Mg2 transporter protein CorA family protein