Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2505067
End position: 2505111
Length: 45

DNA sequence
>NC_012669, from 2505067 to 2505111 (45 bp); Beutenbergia cavernae DSM 12333 CCGACGGCGAGCACGACGACCGCGAGCCCGGCGGCGGCGAGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2504749-2505354	Sequence	Bcav_2226 - hypothetical protein (Protein is coded in complementary strand; from 2505354 to 2504749)